What is a gene?

A gene is the basic physical and functional unit of heredity. Genes, which are made up of DNA, act as instructions to make molecules called proteins. In humans, genes vary in size from a few hundred DNA bases to more than 2 million bases. The Human Genome Project has estimated that humans have between 20,000 and 25,000 genes.

Every person has two copies of each gene, one inherited from each parent. Most genes are the same in all people, but a small number of genes (less than 1 percent of the total) are slightly different between people. Alleles are forms of the same gene with small differences in their sequence of DNA bases. These small differences contribute to each person’s unique physical features.

How many chromosomes do people have?

In humans, each cell normally contains 23 pairs of chromosomes, for a total of 46. Twenty-two of these pairs, called autosomes, look the same in both males and females. The 23rd pair, the sex chromosomes, differ between males and females. Females have two copies of the X chromosome, while males have one X and one Y chromosome.

What is a chromosome?

In the nucleus of each cell, the DNA molecule is packaged into thread-like structures called chromosomes. Each chromosome is made up of DNA tightly coiled many times around proteins called histones that support its structure.

Chromosomes are not visible in the cell’s nucleus—not even under a microscope—when the cell is not dividing. However, the DNA that makes up chromosomes becomes more tightly packed during cell division and is then visible under a microscope. Most of what researchers know about chromosomes was learned by observing chromosomes during cell division.

Each chromosome has a constriction point called the centromere, which divides the chromosome into two sections, or “arms.” The short arm of the chromosome is labeled the “p arm.” The long arm of the chromosome is labeled the “q arm.” The location of the centromere on each chromosome gives the chromosome its characteristic shape, and can be used to help describe the location of specific genes

What is genetic testing?

Genetic testing is a type of medical test that identifies changes in chromosomes, genes, or proteins. Most of the time, testing is used to find changes that are associated with inherited disorders. The results of a genetic test can confirm or rule out a suspected genetic condition or help determine a person’s chance of developing or passing on a genetic disorder. Several hundred genetic tests are currently in use, and more are being developed.

Genetic testing is voluntary. Because testing has both benefits and limitations, the decision about whether to be tested is a personal and complex one. A genetic counselor can help by providing information about the pros and cons of the test and discussing the social and emotional aspects of testing.

What is mitochondrial DNA?

Although most DNA is packaged in chromosomes within the nucleus, mitochondria also have a small amount of their own DNA. This genetic material is known as mitochondrial DNA or mtDNA.

Mitochondria (illustration) are structures within cells that convert the energy from food into a form that cells can use. Each cell contains hundreds to thousands of mitochondria, which are located in the fluid that surrounds the nucleus (the cytoplasm).

Mitochondria produce energy through a process called oxidative phosphorylation. This process uses oxygen and simple sugars to create adenosine triphosphate (ATP), the cell’s main energy source. A set of enzyme complexes, designated as complexes I-V, carry out oxidative phosphorylation within mitochondria.

In addition to energy production, mitochondria play a role in several other cellular activities. For example, mitochondria help regulate the self-destruction of cells (apoptosis). They are also necessary for the production of substances such as cholesterol and heme (a component of hemoglobin, the molecule that carries oxygen in the blood).

Mitochondrial DNA contains 37 genes, all of which are essential for normal mitochondrial function. Thirteen of these genes provide instructions for making enzymes involved in oxidative phosphorylation. The remaining genes provide instructions for making molecules called transfer RNAs (tRNAs) and ribosomal RNAs (rRNAs), which are chemical cousins of DNA. These types of RNA help assemble protein building blocks (amino acids) into functioning proteins.

DNA profiles for forensic use

Each of the chromosomes in your cells contains sections of non-coding DNA — DNA that does not code for a protein. Non-coding DNA contains areas called short tandem repeats (STRs), made up of repeats of short base sequences, such as CATG in the sequence CATGCATGCATG.

If the DNA of two people was analysed for 10 different STRs on different chromosomes, there is only one chance in a million that they would have the same number of repeats in all of these STRs. Identical twins are the only exception — they have identical DNA and identical STRs.

If a crime suspect's DNA profile for 10 STRs matches the STR profile of a sample found at the crime scene, there is a very high probability that both lots of DNA are from the same person. However, if the profiles differ for even one STR, this cannot be assumed.

DNA is used as evidence in court, but it is considered ‘circumstantial' evidence, and can only be used as proof with other supporting evidence. However, it has proven useful in establishing the innocence of suspects.

DNA profiling

Each of us has a unique DNA profile or fingerprint. A technique called electrophoresis is used to obtain DNA profiles, relying on sections of our DNA that are known as non-coding DNA (DNA that does not code for a protein).

We have many sections of non-coding DNA in our genome. Within this non-coding DNA are areas called short tandem repeats (STRs). For example, you may have a stretch of DNA made up of the following base sequence:

ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATAGCACAT

This sequence starts off looking random, but then has repeats of the sequence CATG towards the middle. It becomes random again near the end. The repetitive section of the sequence is what is referred to as an STR.

For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents. For example, you may have inherited 11 repeats of the CATG sequence, as shown above, on a chromosome from your mother, and 3 repeats of this sequence within the STR on the matching chromosome from your father.

The different numbers of repeats within an STR results in DNA of different lengths. Because of this, electrophoresis can be used to show how many repeats you have.

Generating a DNA profile usually involves analysing an individual's DNA for ten different STRs on different chromosomes. Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs.

Polymerase chain reaction (PCR) is used to produce many copies of the ten STRs before they are later analysed using electrophoresis. The different lengths of DNA will show up as bands at different spots on the electrophoresis gel (see picture above). The banding pattern produced is called a DNA profile or fingerprint, and can be analysed.