What is a gene?

A gene is the basic physical and functional unit of heredity. Genes, which are made up of DNA, act as instructions to make molecules called proteins. In humans, genes vary in size from a few hundred DNA bases to more than 2 million bases. The Human Genome Project has estimated that humans have between 20,000 and 25,000 genes.

Every person has two copies of each gene, one inherited from each parent. Most genes are the same in all people, but a small number of genes (less than 1 percent of the total) are slightly different between people. Alleles are forms of the same gene with small differences in their sequence of DNA bases. These small differences contribute to each person’s unique physical features.

How many chromosomes do people have?

In humans, each cell normally contains 23 pairs of chromosomes, for a total of 46. Twenty-two of these pairs, called autosomes, look the same in both males and females. The 23rd pair, the sex chromosomes, differ between males and females. Females have two copies of the X chromosome, while males have one X and one Y chromosome.

What is a chromosome?

In the nucleus of each cell, the DNA molecule is packaged into thread-like structures called chromosomes. Each chromosome is made up of DNA tightly coiled many times around proteins called histones that support its structure.

Chromosomes are not visible in the cell’s nucleus—not even under a microscope—when the cell is not dividing. However, the DNA that makes up chromosomes becomes more tightly packed during cell division and is then visible under a microscope. Most of what researchers know about chromosomes was learned by observing chromosomes during cell division.

Each chromosome has a constriction point called the centromere, which divides the chromosome into two sections, or “arms.” The short arm of the chromosome is labeled the “p arm.” The long arm of the chromosome is labeled the “q arm.” The location of the centromere on each chromosome gives the chromosome its characteristic shape, and can be used to help describe the location of specific genes

What is genetic testing?

Genetic testing is a type of medical test that identifies changes in chromosomes, genes, or proteins. Most of the time, testing is used to find changes that are associated with inherited disorders. The results of a genetic test can confirm or rule out a suspected genetic condition or help determine a person’s chance of developing or passing on a genetic disorder. Several hundred genetic tests are currently in use, and more are being developed.

Genetic testing is voluntary. Because testing has both benefits and limitations, the decision about whether to be tested is a personal and complex one. A genetic counselor can help by providing information about the pros and cons of the test and discussing the social and emotional aspects of testing.

What is mitochondrial DNA?

Although most DNA is packaged in chromosomes within the nucleus, mitochondria also have a small amount of their own DNA. This genetic material is known as mitochondrial DNA or mtDNA.

Mitochondria (illustration) are structures within cells that convert the energy from food into a form that cells can use. Each cell contains hundreds to thousands of mitochondria, which are located in the fluid that surrounds the nucleus (the cytoplasm).

Mitochondria produce energy through a process called oxidative phosphorylation. This process uses oxygen and simple sugars to create adenosine triphosphate (ATP), the cell’s main energy source. A set of enzyme complexes, designated as complexes I-V, carry out oxidative phosphorylation within mitochondria.

In addition to energy production, mitochondria play a role in several other cellular activities. For example, mitochondria help regulate the self-destruction of cells (apoptosis). They are also necessary for the production of substances such as cholesterol and heme (a component of hemoglobin, the molecule that carries oxygen in the blood).

Mitochondrial DNA contains 37 genes, all of which are essential for normal mitochondrial function. Thirteen of these genes provide instructions for making enzymes involved in oxidative phosphorylation. The remaining genes provide instructions for making molecules called transfer RNAs (tRNAs) and ribosomal RNAs (rRNAs), which are chemical cousins of DNA. These types of RNA help assemble protein building blocks (amino acids) into functioning proteins.

DNA profiles for forensic use

Each of the chromosomes in your cells contains sections of non-coding DNA — DNA that does not code for a protein. Non-coding DNA contains areas called short tandem repeats (STRs), made up of repeats of short base sequences, such as CATG in the sequence CATGCATGCATG.

If the DNA of two people was analysed for 10 different STRs on different chromosomes, there is only one chance in a million that they would have the same number of repeats in all of these STRs. Identical twins are the only exception — they have identical DNA and identical STRs.

If a crime suspect's DNA profile for 10 STRs matches the STR profile of a sample found at the crime scene, there is a very high probability that both lots of DNA are from the same person. However, if the profiles differ for even one STR, this cannot be assumed.

DNA is used as evidence in court, but it is considered ‘circumstantial' evidence, and can only be used as proof with other supporting evidence. However, it has proven useful in establishing the innocence of suspects.

DNA profiling

Each of us has a unique DNA profile or fingerprint. A technique called electrophoresis is used to obtain DNA profiles, relying on sections of our DNA that are known as non-coding DNA (DNA that does not code for a protein).

We have many sections of non-coding DNA in our genome. Within this non-coding DNA are areas called short tandem repeats (STRs). For example, you may have a stretch of DNA made up of the following base sequence:

ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATAGCACAT

This sequence starts off looking random, but then has repeats of the sequence CATG towards the middle. It becomes random again near the end. The repetitive section of the sequence is what is referred to as an STR.

For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents. For example, you may have inherited 11 repeats of the CATG sequence, as shown above, on a chromosome from your mother, and 3 repeats of this sequence within the STR on the matching chromosome from your father.

The different numbers of repeats within an STR results in DNA of different lengths. Because of this, electrophoresis can be used to show how many repeats you have.

Generating a DNA profile usually involves analysing an individual's DNA for ten different STRs on different chromosomes. Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs.

Polymerase chain reaction (PCR) is used to produce many copies of the ten STRs before they are later analysed using electrophoresis. The different lengths of DNA will show up as bands at different spots on the electrophoresis gel (see picture above). The banding pattern produced is called a DNA profile or fingerprint, and can be analysed.

Genes code for proteins

Genes contain the coded formula needed by the cell to produce proteins. Proteins are the most common of the complex molecules in your body. Types of proteins include:
structural proteins, such as those which form hair, skin and muscle
messenger proteins, such as hormones, which travel around your body controlling such things as the sugar content of your blood
enzymes, which carry out most of the life processes inside your body, for example making haemoglobin for your red blood cells.

How genes work

To do their job, genes need more than just the code for a product. Each gene also has regulatory (manager) sections, which are important for its control.

The first regulator is a promoter that controls such things as switching the gene off or on. This effectively controls which cells the gene will work in, when the gene will work, for how long and how hard.

The second regulator comes at the end of the gene. This is the stop regulator that controls when the gene will stop working and how long the product of the gene will last. Between these two regulator sections of the gene is the code for the protein product.

Each organism has its own regulators. So, an entire gene from one organism will not automatically work if it is placed in a different organism.

To make a gene work in a different organism, the regulator sections specific to that organism usually need to be inserted along with the gene.

What is a gene?

The DNA double helix stores information in the form of a genetic code. Sections of DNA that contain complete messages are known as genes. They can be thought of as 'words' along the DNA 'sentences'.

Genes are messages that provide the information for all cellular functions. They carry information that is passed on to future generations.

An organism's genes determine:
the characteristics that are used to classify it into the plant or animal kingdom and into a specific family and species
how it uses food
how well it fights infection
at times, how it behaves.

Each human cell (except red blood cells) contains between 25,000 and 42,000 genes. Genes control the production of proteins that make up most of your body.

DNA unknown

In between the well-structured genes are large sections of DNA for which no function has yet been identified. These areas have been called ‘junk DNA’ or 'non-coding DNA' and make up a large proportion of the genomes of both plants and animals.

But is it junk at all?

We don’t really know. This DNA appears to act as a filler in between genes and a number of ideas are starting to emerge about what role it plays. This is a mystery to be solved in the next couple of decades.

Some of the ideas are:
o it is where defective genes, or pseudogenes, are dumped
o it is the accumulated DNA of viruses that have infected the body and failed to take over the cell
o it acts as a protective buffer against genetic damage and harmful mutations, because the area is irrelevant to the metabolic and developmental processes (if a random change occurs in the sequence, there is no effect on the body)
o it acts as a reservoir of sequences from which potentially advantageous new genes can emerge

Researchers believe that this unknown DNA probably plays some role in regulating the 'coding DNA' and therefore cellular processes. But there is currently very little knowledge about the relationship between non-coding DNA and the DNA of genes.

How does DNA work?

DNA is an ideal molecule to transfer genetic messages to every cell of your body. When an egg and sperm met to form the first cell that was to become you, you were given the complete genetic code that all of your cells will use for the rest of your life.

In that first cell, half of the chromosomes (half of the DNA molecules) came from your father and the other half came from your mother.

The first cell divided to become two cells, these both divided to become four, then eight then 16 and so on. Some of the cells in your body are still dividing, for example to produce new skin or blood cells. Most of the time a cell divides perfectly and each of the DNA molecules is copied exactly, with one copy going to each of the new cells. If mistakes are made, they are fixed or the cell is marked for destruction.

If a problem occurs in this process the new cells often die, but on rare occasions the faulty cells survive and can cause a wide range of problems. However, sometimes these faults (mutations) can be beneficial for the organism: this is the basis for evolution.

In order to make a copy of itself, the DNA molecule unzips lengthwise, leaving unpaired bases along each backbone. Nucleotides, which are made up of a sugar, a phosphate and one of the four bases, float freely in the nucleus. Because A can only pair with T and G can only pair with C, the nucleotides match up with the unpaired bases along the DNA backbone. Like building blocks, they form a new strand that is complementary to (matching) the sequence. This forms strands identical to the original strand before it unzipped.

DNA Analysis Definition

DNA as identification

Almost every part of each strain of human DNA is the same. However, except for identical twins, everyone on earth has certain unique features in their DNA, which can be used as a form of identification.

History

The first DNA analysis technology was restriction fragment length polymorphism (RFLP); later, polymerase chain reaction (PCR) allowed the use of very small
DNA samples. The FBI standard today is short tandem repeat (STI) analysis.

STI analysis

STI analysis uses 13 portions, or loci, of the human genome. The odds that two unrelated people would have the same DNA in all 13 loci are about 1 in a billion.

CODIS

The Combined DNA Index System (CODIS) keeps a record of the STI loci for those convicted of violent or sex crimes. If one of these convicts later leaves DNA at a crime scene, it may be used at trial as evidence.

Other Techniques

Mitochondrial DNA analysis uses DNA from sources that can't be used in STI analysis. Y chromosome analysis allows separation of multiple DNA contributors in a sample.

What Is Necessary for DNA Testing?

What is DNA?
DNA is an acid that resides in the nucleus of all living organisms and contains instructions that determine how organisms develop. For humans, our sex, race and any health issues are determined by our DNA.

Types of DNA Tests

There are typically two types of DNA tests, mitochondrial and Y-chromosome. Mitochondrial testing traces a subject's history through the mother's side of the family, while Y-chromosome testing traces history through the father's side.

DNA Test Needs

Tissue or fluid such as sample of saliva, blood or semen is required for genetic testing. Tissue is typically acquired by scraping the subject's cheek with a swab.

DNA tests are conducted in laboratories by qualified forensic personnel by examining strands of DNA from the tissue sample.

Other DNA Tests

Autosomal DNA tests identify a person's ancestry by geographic origin and by percentage--for example, 65 percent French, 20 percent English, 15 percent African. A paternity or maternity test is a high-profile type of autosomal DNA test that matches a child to a father or mother.

Accuracy of DNA Tests

DNA testing typically provide 99.9 percent accuracy, although the accuracy decreases if attempting to differentiate among siblings, since their DNA can be quite similar.

What Is the Procedure for DNA Testing?

There are various ways to test DNA. One very common method used in various settings, including forensic and paternity testing labs, is polyermase chain reaction, or PCR. Using this method, DNA is extracted from sample cells and primers are used to locate the sequence of interest on the DNA strand. This sequence is then amplified to create many million and even billions of copies, according to University of Washington professor Donald E. Riley.

In the case of paternity testing, somatic, or body, cells from the possible father are obtained by taking a swab of the inner lining of the suspected father's mouth. The DNA is extracted from the cells and is then amplified, creating many copies.

These copies are then compared to those of the offspring to see whether there is a close match, according to one Buzzle writer. As stated by professor Riley, although PCR is less time-consuming and cheaper than another method called RFLP, it is very susceptible to contamination and care must be exercised during the entire testing process.

In RFLP, or Restriction Fragment Length Polymorphism, a restriction enzyme is used. Obtained by bacteria that can "cut" DNA at a particular location, restriction enzymes cut many copies of the DNA sequence of interest. The sequence is then separated according to size using gel electrophoresis. Next, "blotting" is performed in which a film is applied to the gel and stained allowing the different bars, representing different sequences, to be seen. This prevents any further migration of the DNA sequences in the gel. A DNA probe is then attached to the sequence of interest.

As in PCR, the DNA copies are compared to others in the population to determine if there is a "match." Rather than just one person's DNA, in the case of paternity testing, DNA from a large population needs to be used in order to effectively compare the lab sample to those in the population. This, along with the increased cost and time required, is the reason that RFLP is no longer widely used as it had been.

DNA 101

DNA is short for deoxyribonucleic acid. Two chains of four chemical bases (abbreviated A, T, C and G) make up DNA and act as a cell’s recipe book to make proteins. The particular sequence of a DNA chain – meaning the precise order of the four chemical bases – determines what protein will be made. A DNA segment beginning with ATTCGC would produce a very different protein than one that starts with CCGTAT. This can be likened to adjusting the order of letters in a word. Though the letters are the same, the meaning changes. For example, act means something very different than cat.

Not all DNA is destined to become a protein. Just as a recipe might contain more information than just a list of ingredients, only some regions of your DNA – called genes – are directly translated into proteins. Cellular machinery follows the instructions written in a gene’s recipe to create a corresponding sequence of messenger ribonucleic acid (mRNA), which is chemically similar to DNA but acts as a messenger, carrying the recipe from the nucleus. Out in the cell’s cytosol, the mRNA sequence is read by more machines, called ribosomes. Following the mRNA instructions, ribosomes string together amino acids, the building blocks that make up proteins. Proteins do most of the work in the cell.

As cells divide, producing two cells where there was once only one, the parent cell’s DNA is duplicated and the same protein-making recipe is passed on to the daughter cell.

Deoxyribonucleic acid (DNA)

Deoxyribonucleic acid (DNA) is a very large biological molecule that is vital in providing information for the development and reproduction of living things.

Every living organism has its own DNA sequence that is like a unique 'barcode' or 'fingerprint'. This inheritable variation in DNA is the most important factor driving evolutionary change over many generations. But, beyond these general characteristics, what "exactly" is DNA? What are the precise physical attributes of this molecule that make its role so centrally imposing in understanding life?

DNA is a long polymer of simple units called nucleotides, held together by a sugar phosphate backbone. Attached to each sugar molecule is a molecule of one of four bases; adenine (A), thymine (T), guanine (G) or cytosine (C), and the order of these bases on the DNA strand encodes information. In most organisms, DNA is a double-helix (or duplex molecule) consisting of two DNA strands coiled around each other, and held together by hydrogen bonds between bases. Because of the chemical nature of these bases, adenine always pairs with thymine and guanine always pairs with cytosine. This complementarity forms the basis of semi-conservative DNA replication — it makes it possible for DNA to be copied relatively simply, while accurately preserving its information content.

The entire DNA sequence of an organism is called its genome. In animals and plants, most DNA is stored inside the cell nucleus. In bacteria, there is no nuclear membrane around the DNA, which is in a region called the nucleoid. Some organelles in eukaryotic cells (mitochondria and chloroplasts) have their own DNA with a similar organisation to bacterial DNA. Viruses have a single type of nucleic acid, either DNA or RNA, directly encased in a protein coat.

DNA Testing

DNA testing has increased in popularity in the recent years in the fields of criminology, biomedicine, biotechnology and family law. This is because with DNA testing, it is possible to find out any biological lineage and genealogical links and thereby help in settling disputes that arise between family members on estate issues. With the help of DNA testing, it is also possible to solve crimes by identifying criminals by testing evidences found in the scene of crime. All that is needed to do a DNA test is a single strand of hair or some blood, semen, saliva or other biological material

With the help of DNA testing, it is possible to find out if two people are related. This is because DNA testing proves how much related these people are, and if two people having the same surname are related. DNA testing can also find out if two descendants hail from the same ancestor. To prove your ancestry, you have to have some biological specimen of the ancestor like hair, buccal cells, saliva, blood or semen which will be compared with your biological specimen.

You can also find out your ethnic origins with the help of DNA testing. People who have migrated to some other place for many years can find out their roots in their parents country with DNA testing. With DNA testing, all court disputes over land and estate, children custody and writing of wills can be settled. This is because DNA testing can prove the relationship between two or more people.

One major application of DNA testing is in forensic identification. DNA test results are much clearer than fingerprints and it is with these results and proof that it is possible to find criminals. Cases of rape can be solved by testing semen, skin scrapings or the hair of the suspect that may be found in the fingernails of the victim.

So it can be seen that DNA testing is sort of a boon to mankind. With the help of DNA testing, the innocent is acquitted while the guilty is charged. Relations and ancestry are determined while parentage and children’s’ custody all are justified with DNA testing.